kaijuno:

In highschool I wrote a story about a middle-generation of stellar travelers. Their parents were born on earth and left as children, and the middle generation will not live long enough to see their destination. They live their entire lives on the ship and I wrote about them trying to find their place in everything. They will never know blue skies and warm beaches and open fields with warm breezes. They’ll never know birdsong or crickets or frogs. They’ll never hear the rain on the roof of a dreary day. I never could find the right way to end the story. I wanted it to be a happy ending, but I didn’t know how to do it.

I realize now that it was a book about me dealing with depression before I even knew it. Looking back at how blatant the projecting was, it’s obvious now. It wasn’t then.

In the story, the middle-generation people are lost. They’re apathetic. They’re just a placeholder. The only job they have is to keep the ship running, have kids, and die. As the middle generation of people began becoming adults, suicide rates were skyrocketing. Crime and drug rates were jumping. This generation was completely apathetic because they felt that they had no use.

In the story, a small group of people in the middle-generation create the Weather Project. They turn the ship into a terrarium. They make magnificent gardens and take the DNA of animals they took with them and recreate them and they make this cold, metal spaceship that they have to live their entire lives on into a home. They take what little they have and they break it and rearrange it into something beautiful. They take this radical idea and turn the ship into a wonderful jungle of trees and birds and sunshine.

And I realize now how much it reflects my state of mind as I transitioned from a child into an adult while dealing with depression. You always hear “it gets better” and “when you’re older things will be easier” and I was so sick of waiting for it to get better. I was in the middle-generation stage. And I was sick of it. I was so sick of waiting.

When I was in highschool I didn’t know how to end the story. I didn’t know how to have a happy ending. I didn’t have the life experience then to finish the story in a meaningful way. I didn’t know how to make it better for these middle-generation characters.

But now that I’m older, I’m learning. That if you sit and wait for things to get better, it never will. You have to take your life and break it apart and rearrange it into something beautiful. You have to make the cold metal ship into the garden that you deserve. You have to make your own meaning. You have to plant your own garden.

You have to teach yourself that being happy is not a radical idea.

fuck-cistrenders:

christmas is coming soon so here’s lots of love for:

  • all the trans boys and nb people who are going to get “girl presents”
  • all the trans girls and nb people who are going to get “boy presents”
  • all the lesbians who are going to be asked why they don’t have a boyfriend
  • all the gay boys who are going to be asked why they don’t have a girlfriend
  • all the closeted kids who are going to have to listen to their families being homophobic and transphobic
  • all the lgbt kids who have to spend time with their abusive family members
  • all the lgbt kids whose families disowned them
  • all the trans boys and nb people who are going to have to dress feminine for their families
  • all the trans girls and nb people who are going to have to dress masculine for their families

lots of love to all of you, i wish you the happiest of holidays ❤️❤️❤️

(via wholesome-gf-memes-uwu)

imsoofuckingsad:

i hate that i’m so absent as a person. i don’t start conversations. i can barely maintain them. i’m so weary and spaced out all the time to the point where i can’t even keep up small talk and i’m just so disappointed in myself

(via forgave)

deepspacepirate:

deepspacepirate:

monkeysky:

intranet:

Incase anything happens to my account here’s my entire genome:

GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…

You got like six unique nucleotides so nice

image
image

OP is a virus from outer space

image
image

FUCK YOU OP

(Source: anneuaidd, via civilwhore)

bemylova:

i😡😡😡😡😡wanna😡😡😡😡😡cuddle😡😡😡😡😡and😡😡😡😡😡😡watch😡😡😡😡😡spooky😡😡😡😡😡movies😡😡😡😡😡with😡😡😡😡😡you😡😡😡😡😡

(via civilwhore)


Indy Theme by Safe As Milk